ID: 1000665421

View in Genome Browser
Species Human (GRCh38)
Location 5:163989213-163989235
Sequence GTGTGTGCGCGCGCGTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000665417_1000665421 29 Left 1000665417 5:163989161-163989183 CCATTCTCTATTTTGAAAGAAGA No data
Right 1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000665421 Original CRISPR GTGTGTGCGCGCGCGTGTGG GGG Intergenic
No off target data available for this crispr