ID: 1000668121

View in Genome Browser
Species Human (GRCh38)
Location 5:164024329-164024351
Sequence TGTCCTTTGCAGGAACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000668121_1000668126 16 Left 1000668121 5:164024329-164024351 CCATCCAGTTCCTGCAAAGGACA No data
Right 1000668126 5:164024368-164024390 TTATGACTGTGTAGTATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000668121 Original CRISPR TGTCCTTTGCAGGAACTGGA TGG (reversed) Intergenic
No off target data available for this crispr