ID: 1000673397

View in Genome Browser
Species Human (GRCh38)
Location 5:164090333-164090355
Sequence GGGCATTCCCTTTGAAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000673397_1000673400 0 Left 1000673397 5:164090333-164090355 CCAGTATTTCAAAGGGAATGCCC No data
Right 1000673400 5:164090356-164090378 ATTCAGTATGACATTGCCTGTGG 0: 3
1: 246
2: 10260
3: 5533
4: 4451
1000673397_1000673401 1 Left 1000673397 5:164090333-164090355 CCAGTATTTCAAAGGGAATGCCC No data
Right 1000673401 5:164090357-164090379 TTCAGTATGACATTGCCTGTGGG 0: 3
1: 239
2: 10203
3: 5480
4: 4486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000673397 Original CRISPR GGGCATTCCCTTTGAAATAC TGG (reversed) Intergenic
No off target data available for this crispr