ID: 1000679622

View in Genome Browser
Species Human (GRCh38)
Location 5:164167209-164167231
Sequence TCTAATATTCAGAGTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000679622_1000679623 -2 Left 1000679622 5:164167209-164167231 CCATCTTCACTCTGAATATTAGA No data
Right 1000679623 5:164167230-164167252 GAAATGAAAATTAAAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000679622 Original CRISPR TCTAATATTCAGAGTGAAGA TGG (reversed) Intergenic
No off target data available for this crispr