ID: 1000679721

View in Genome Browser
Species Human (GRCh38)
Location 5:164168453-164168475
Sequence GATGACATGGTGAATTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000679716_1000679721 2 Left 1000679716 5:164168428-164168450 CCCCCAATACTTTATATCACTTA No data
Right 1000679721 5:164168453-164168475 GATGACATGGTGAATTAGTCAGG No data
1000679717_1000679721 1 Left 1000679717 5:164168429-164168451 CCCCAATACTTTATATCACTTAA No data
Right 1000679721 5:164168453-164168475 GATGACATGGTGAATTAGTCAGG No data
1000679719_1000679721 -1 Left 1000679719 5:164168431-164168453 CCAATACTTTATATCACTTAAAG No data
Right 1000679721 5:164168453-164168475 GATGACATGGTGAATTAGTCAGG No data
1000679718_1000679721 0 Left 1000679718 5:164168430-164168452 CCCAATACTTTATATCACTTAAA No data
Right 1000679721 5:164168453-164168475 GATGACATGGTGAATTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000679721 Original CRISPR GATGACATGGTGAATTAGTC AGG Intergenic
No off target data available for this crispr