ID: 1000682630

View in Genome Browser
Species Human (GRCh38)
Location 5:164204883-164204905
Sequence ATGTTAATTAGGAGTAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000682627_1000682630 5 Left 1000682627 5:164204855-164204877 CCTATGAGACAAGTACTATATTA No data
Right 1000682630 5:164204883-164204905 ATGTTAATTAGGAGTAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000682630 Original CRISPR ATGTTAATTAGGAGTAATCA AGG Intergenic
No off target data available for this crispr