ID: 1000686742

View in Genome Browser
Species Human (GRCh38)
Location 5:164259230-164259252
Sequence CAGGGGAATCTCCATGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000686742_1000686747 16 Left 1000686742 5:164259230-164259252 CCAGCTTCATGGAGATTCCCCTG No data
Right 1000686747 5:164259269-164259291 GAGTTCAGCAGCAGATGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000686742 Original CRISPR CAGGGGAATCTCCATGAAGC TGG (reversed) Intergenic
No off target data available for this crispr