ID: 1000686747

View in Genome Browser
Species Human (GRCh38)
Location 5:164259269-164259291
Sequence GAGTTCAGCAGCAGATGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000686745_1000686747 -3 Left 1000686745 5:164259249-164259271 CCTGCTACCTGCACAGCTTAGAG No data
Right 1000686747 5:164259269-164259291 GAGTTCAGCAGCAGATGCAAAGG No data
1000686742_1000686747 16 Left 1000686742 5:164259230-164259252 CCAGCTTCATGGAGATTCCCCTG No data
Right 1000686747 5:164259269-164259291 GAGTTCAGCAGCAGATGCAAAGG No data
1000686746_1000686747 -10 Left 1000686746 5:164259256-164259278 CCTGCACAGCTTAGAGTTCAGCA No data
Right 1000686747 5:164259269-164259291 GAGTTCAGCAGCAGATGCAAAGG No data
1000686743_1000686747 -1 Left 1000686743 5:164259247-164259269 CCCCTGCTACCTGCACAGCTTAG No data
Right 1000686747 5:164259269-164259291 GAGTTCAGCAGCAGATGCAAAGG No data
1000686744_1000686747 -2 Left 1000686744 5:164259248-164259270 CCCTGCTACCTGCACAGCTTAGA No data
Right 1000686747 5:164259269-164259291 GAGTTCAGCAGCAGATGCAAAGG No data
1000686741_1000686747 17 Left 1000686741 5:164259229-164259251 CCCAGCTTCATGGAGATTCCCCT No data
Right 1000686747 5:164259269-164259291 GAGTTCAGCAGCAGATGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000686747 Original CRISPR GAGTTCAGCAGCAGATGCAA AGG Intergenic
No off target data available for this crispr