ID: 1000688723

View in Genome Browser
Species Human (GRCh38)
Location 5:164287710-164287732
Sequence CCAGACTGTGAAGCCATCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000688723_1000688727 30 Left 1000688723 5:164287710-164287732 CCTAAGATGGCTTCACAGTCTGG No data
Right 1000688727 5:164287763-164287785 AGCTTGTGTGGATTGTCTGTAGG No data
1000688723_1000688726 18 Left 1000688723 5:164287710-164287732 CCTAAGATGGCTTCACAGTCTGG No data
Right 1000688726 5:164287751-164287773 TCTTTTTATCAAAGCTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000688723 Original CRISPR CCAGACTGTGAAGCCATCTT AGG (reversed) Intergenic
No off target data available for this crispr