ID: 1000695173

View in Genome Browser
Species Human (GRCh38)
Location 5:164371689-164371711
Sequence CAGTGGGACAAGATGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000695160_1000695173 7 Left 1000695160 5:164371659-164371681 CCATGTGTGTTATTGCCCCTAAG No data
Right 1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG No data
1000695166_1000695173 -10 Left 1000695166 5:164371676-164371698 CCTAAGGACCTTCCAGTGGGACA No data
Right 1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG No data
1000695164_1000695173 -8 Left 1000695164 5:164371674-164371696 CCCCTAAGGACCTTCCAGTGGGA No data
Right 1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG No data
1000695165_1000695173 -9 Left 1000695165 5:164371675-164371697 CCCTAAGGACCTTCCAGTGGGAC No data
Right 1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000695173 Original CRISPR CAGTGGGACAAGATGGAAGG GGG Intergenic
No off target data available for this crispr