ID: 1000697406

View in Genome Browser
Species Human (GRCh38)
Location 5:164404757-164404779
Sequence TATTACATATAGCACATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000697405_1000697406 18 Left 1000697405 5:164404716-164404738 CCTTATTATTTCTTGCTCTTTTT No data
Right 1000697406 5:164404757-164404779 TATTACATATAGCACATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000697406 Original CRISPR TATTACATATAGCACATGCA TGG Intergenic
No off target data available for this crispr