ID: 1000697754

View in Genome Browser
Species Human (GRCh38)
Location 5:164409813-164409835
Sequence CTCTCATGACTGATAATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000697754_1000697757 30 Left 1000697754 5:164409813-164409835 CCTGGTATTATCAGTCATGAGAG No data
Right 1000697757 5:164409866-164409888 AAAAAAATAATAACTAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000697754 Original CRISPR CTCTCATGACTGATAATACC AGG (reversed) Intergenic
No off target data available for this crispr