ID: 1000699651

View in Genome Browser
Species Human (GRCh38)
Location 5:164433053-164433075
Sequence CTGGTTGTGAAACATTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000699651_1000699653 -4 Left 1000699651 5:164433053-164433075 CCAGAAAAATGTTTCACAACCAG No data
Right 1000699653 5:164433072-164433094 CCAGACCAAGAGAAAATGCCAGG No data
1000699651_1000699658 23 Left 1000699651 5:164433053-164433075 CCAGAAAAATGTTTCACAACCAG No data
Right 1000699658 5:164433099-164433121 TGCTTGGTGCTAGGTGCATGTGG No data
1000699651_1000699657 14 Left 1000699651 5:164433053-164433075 CCAGAAAAATGTTTCACAACCAG No data
Right 1000699657 5:164433090-164433112 CCAGGATGCTGCTTGGTGCTAGG No data
1000699651_1000699660 25 Left 1000699651 5:164433053-164433075 CCAGAAAAATGTTTCACAACCAG No data
Right 1000699660 5:164433101-164433123 CTTGGTGCTAGGTGCATGTGGGG No data
1000699651_1000699661 30 Left 1000699651 5:164433053-164433075 CCAGAAAAATGTTTCACAACCAG No data
Right 1000699661 5:164433106-164433128 TGCTAGGTGCATGTGGGGCCAGG No data
1000699651_1000699659 24 Left 1000699651 5:164433053-164433075 CCAGAAAAATGTTTCACAACCAG No data
Right 1000699659 5:164433100-164433122 GCTTGGTGCTAGGTGCATGTGGG No data
1000699651_1000699655 7 Left 1000699651 5:164433053-164433075 CCAGAAAAATGTTTCACAACCAG No data
Right 1000699655 5:164433083-164433105 GAAAATGCCAGGATGCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000699651 Original CRISPR CTGGTTGTGAAACATTTTTC TGG (reversed) Intergenic
No off target data available for this crispr