ID: 1000699655

View in Genome Browser
Species Human (GRCh38)
Location 5:164433083-164433105
Sequence GAAAATGCCAGGATGCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000699651_1000699655 7 Left 1000699651 5:164433053-164433075 CCAGAAAAATGTTTCACAACCAG No data
Right 1000699655 5:164433083-164433105 GAAAATGCCAGGATGCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000699655 Original CRISPR GAAAATGCCAGGATGCTGCT TGG Intergenic
No off target data available for this crispr