ID: 1000701394

View in Genome Browser
Species Human (GRCh38)
Location 5:164455616-164455638
Sequence CTATAGATACCTAGTGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000701394_1000701406 18 Left 1000701394 5:164455616-164455638 CCCCCTTCACTAGGTATCTATAG No data
Right 1000701406 5:164455657-164455679 GCATAACCAATGGGAAAGAGGGG No data
1000701394_1000701404 16 Left 1000701394 5:164455616-164455638 CCCCCTTCACTAGGTATCTATAG No data
Right 1000701404 5:164455655-164455677 TGGCATAACCAATGGGAAAGAGG No data
1000701394_1000701401 8 Left 1000701394 5:164455616-164455638 CCCCCTTCACTAGGTATCTATAG No data
Right 1000701401 5:164455647-164455669 TGGACGCCTGGCATAACCAATGG No data
1000701394_1000701405 17 Left 1000701394 5:164455616-164455638 CCCCCTTCACTAGGTATCTATAG No data
Right 1000701405 5:164455656-164455678 GGCATAACCAATGGGAAAGAGGG No data
1000701394_1000701400 -4 Left 1000701394 5:164455616-164455638 CCCCCTTCACTAGGTATCTATAG No data
Right 1000701400 5:164455635-164455657 ATAGGATGATCATGGACGCCTGG No data
1000701394_1000701402 9 Left 1000701394 5:164455616-164455638 CCCCCTTCACTAGGTATCTATAG No data
Right 1000701402 5:164455648-164455670 GGACGCCTGGCATAACCAATGGG No data
1000701394_1000701409 24 Left 1000701394 5:164455616-164455638 CCCCCTTCACTAGGTATCTATAG No data
Right 1000701409 5:164455663-164455685 CCAATGGGAAAGAGGGGGTTAGG No data
1000701394_1000701407 19 Left 1000701394 5:164455616-164455638 CCCCCTTCACTAGGTATCTATAG No data
Right 1000701407 5:164455658-164455680 CATAACCAATGGGAAAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000701394 Original CRISPR CTATAGATACCTAGTGAAGG GGG (reversed) Intergenic
No off target data available for this crispr