ID: 1000712186

View in Genome Browser
Species Human (GRCh38)
Location 5:164594540-164594562
Sequence CAAGCTTCTCTCATTAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000712186_1000712191 -7 Left 1000712186 5:164594540-164594562 CCTAAATTAATGAGAGAAGCTTG No data
Right 1000712191 5:164594556-164594578 AAGCTTGGTAACGGGGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000712186 Original CRISPR CAAGCTTCTCTCATTAATTT AGG (reversed) Intergenic
No off target data available for this crispr