ID: 1000715100

View in Genome Browser
Species Human (GRCh38)
Location 5:164632645-164632667
Sequence TAATTAGCTGGCATTCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000715098_1000715100 -9 Left 1000715098 5:164632631-164632653 CCACACTGTGTTTATAATTAGCT No data
Right 1000715100 5:164632645-164632667 TAATTAGCTGGCATTCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000715100 Original CRISPR TAATTAGCTGGCATTCTTAA AGG Intergenic
No off target data available for this crispr