ID: 1000719790

View in Genome Browser
Species Human (GRCh38)
Location 5:164692586-164692608
Sequence TGCCCTCTAGAAGCTGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000719788_1000719790 -1 Left 1000719788 5:164692564-164692586 CCCATGAGTCAAGGAACACAGGT No data
Right 1000719790 5:164692586-164692608 TGCCCTCTAGAAGCTGAAAGTGG No data
1000719789_1000719790 -2 Left 1000719789 5:164692565-164692587 CCATGAGTCAAGGAACACAGGTG No data
Right 1000719790 5:164692586-164692608 TGCCCTCTAGAAGCTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000719790 Original CRISPR TGCCCTCTAGAAGCTGAAAG TGG Intergenic
No off target data available for this crispr