ID: 1000720925

View in Genome Browser
Species Human (GRCh38)
Location 5:164705601-164705623
Sequence CTGTGTTGGTAGAGGTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000720919_1000720925 12 Left 1000720919 5:164705566-164705588 CCATTGCCTATTTCAAATTCACC No data
Right 1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG No data
1000720920_1000720925 6 Left 1000720920 5:164705572-164705594 CCTATTTCAAATTCACCATTTAT No data
Right 1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG No data
1000720921_1000720925 -9 Left 1000720921 5:164705587-164705609 CCATTTATCTAAAGCTGTGTTGG No data
Right 1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000720925 Original CRISPR CTGTGTTGGTAGAGGTAGGA TGG Intergenic
No off target data available for this crispr