ID: 1000721943

View in Genome Browser
Species Human (GRCh38)
Location 5:164719040-164719062
Sequence CTGCTTGTGCCTCCTCCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000721939_1000721943 26 Left 1000721939 5:164718991-164719013 CCTGGTAATTGCCTTTCTGCTAA No data
Right 1000721943 5:164719040-164719062 CTGCTTGTGCCTCCTCCCATTGG No data
1000721940_1000721943 15 Left 1000721940 5:164719002-164719024 CCTTTCTGCTAAGTTGAGAGTTG No data
Right 1000721943 5:164719040-164719062 CTGCTTGTGCCTCCTCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000721943 Original CRISPR CTGCTTGTGCCTCCTCCCAT TGG Intergenic
No off target data available for this crispr