ID: 1000739753

View in Genome Browser
Species Human (GRCh38)
Location 5:164953363-164953385
Sequence TCTTGCAAACAGTTTTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000739752_1000739753 -9 Left 1000739752 5:164953349-164953371 CCAACTTATTTAACTCTTGCAAA No data
Right 1000739753 5:164953363-164953385 TCTTGCAAACAGTTTTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000739753 Original CRISPR TCTTGCAAACAGTTTTATGT AGG Intergenic
No off target data available for this crispr