ID: 1000747937

View in Genome Browser
Species Human (GRCh38)
Location 5:165058468-165058490
Sequence AGGAAGCTAAATCTCATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000747936_1000747937 -8 Left 1000747936 5:165058453-165058475 CCTGTTTCATAGATAAGGAAGCT No data
Right 1000747937 5:165058468-165058490 AGGAAGCTAAATCTCATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000747937 Original CRISPR AGGAAGCTAAATCTCATGAG AGG Intergenic
No off target data available for this crispr