ID: 1000748235

View in Genome Browser
Species Human (GRCh38)
Location 5:165062143-165062165
Sequence CAGTGGATCTAGAGCGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000748235_1000748240 12 Left 1000748235 5:165062143-165062165 CCCTGTTCGCTCTAGATCCACTG No data
Right 1000748240 5:165062178-165062200 GACAAGAAAGTTTACATCAGTGG No data
1000748235_1000748241 13 Left 1000748235 5:165062143-165062165 CCCTGTTCGCTCTAGATCCACTG No data
Right 1000748241 5:165062179-165062201 ACAAGAAAGTTTACATCAGTGGG No data
1000748235_1000748243 21 Left 1000748235 5:165062143-165062165 CCCTGTTCGCTCTAGATCCACTG No data
Right 1000748243 5:165062187-165062209 GTTTACATCAGTGGGACGGCAGG No data
1000748235_1000748242 17 Left 1000748235 5:165062143-165062165 CCCTGTTCGCTCTAGATCCACTG No data
Right 1000748242 5:165062183-165062205 GAAAGTTTACATCAGTGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000748235 Original CRISPR CAGTGGATCTAGAGCGAACA GGG (reversed) Intergenic
No off target data available for this crispr