ID: 1000751074

View in Genome Browser
Species Human (GRCh38)
Location 5:165097449-165097471
Sequence ACTAGGCAGTGCCCCAGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000751066_1000751074 10 Left 1000751066 5:165097416-165097438 CCAGGATCTGGGGGACTGTAGCC No data
Right 1000751074 5:165097449-165097471 ACTAGGCAGTGCCCCAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000751074 Original CRISPR ACTAGGCAGTGCCCCAGTAA GGG Intergenic
No off target data available for this crispr