ID: 1000759001

View in Genome Browser
Species Human (GRCh38)
Location 5:165197835-165197857
Sequence AAGGGAAAACATGCAGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000759001_1000759006 21 Left 1000759001 5:165197835-165197857 CCAAATACTGCATGTTTTCCCTT No data
Right 1000759006 5:165197879-165197901 AGAACTCATGAACACAAAGAAGG No data
1000759001_1000759007 22 Left 1000759001 5:165197835-165197857 CCAAATACTGCATGTTTTCCCTT No data
Right 1000759007 5:165197880-165197902 GAACTCATGAACACAAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000759001 Original CRISPR AAGGGAAAACATGCAGTATT TGG (reversed) Intergenic