ID: 1000759004

View in Genome Browser
Species Human (GRCh38)
Location 5:165197853-165197875
Sequence CATTTAGCTCCCACTCATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000759004_1000759006 3 Left 1000759004 5:165197853-165197875 CCCTTATGAGTGGGAGCTAAATG No data
Right 1000759006 5:165197879-165197901 AGAACTCATGAACACAAAGAAGG No data
1000759004_1000759009 20 Left 1000759004 5:165197853-165197875 CCCTTATGAGTGGGAGCTAAATG No data
Right 1000759009 5:165197896-165197918 AGAAGGGAACAGCAGACACTGGG No data
1000759004_1000759007 4 Left 1000759004 5:165197853-165197875 CCCTTATGAGTGGGAGCTAAATG No data
Right 1000759007 5:165197880-165197902 GAACTCATGAACACAAAGAAGGG No data
1000759004_1000759008 19 Left 1000759004 5:165197853-165197875 CCCTTATGAGTGGGAGCTAAATG No data
Right 1000759008 5:165197895-165197917 AAGAAGGGAACAGCAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000759004 Original CRISPR CATTTAGCTCCCACTCATAA GGG (reversed) Intergenic