ID: 1000759004

View in Genome Browser
Species Human (GRCh38)
Location 5:165197853-165197875
Sequence CATTTAGCTCCCACTCATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000759004_1000759009 20 Left 1000759004 5:165197853-165197875 CCCTTATGAGTGGGAGCTAAATG No data
Right 1000759009 5:165197896-165197918 AGAAGGGAACAGCAGACACTGGG 0: 24
1: 278
2: 1209
3: 3372
4: 8111
1000759004_1000759007 4 Left 1000759004 5:165197853-165197875 CCCTTATGAGTGGGAGCTAAATG No data
Right 1000759007 5:165197880-165197902 GAACTCATGAACACAAAGAAGGG 0: 98
1: 184
2: 390
3: 1162
4: 4046
1000759004_1000759008 19 Left 1000759004 5:165197853-165197875 CCCTTATGAGTGGGAGCTAAATG No data
Right 1000759008 5:165197895-165197917 AAGAAGGGAACAGCAGACACTGG 0: 25
1: 303
2: 1069
3: 2150
4: 4636
1000759004_1000759006 3 Left 1000759004 5:165197853-165197875 CCCTTATGAGTGGGAGCTAAATG No data
Right 1000759006 5:165197879-165197901 AGAACTCATGAACACAAAGAAGG 0: 109
1: 486
2: 1000
3: 3333
4: 10568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000759004 Original CRISPR CATTTAGCTCCCACTCATAA GGG (reversed) Intergenic
No off target data available for this crispr