ID: 1000759006

View in Genome Browser
Species Human (GRCh38)
Location 5:165197879-165197901
Sequence AGAACTCATGAACACAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000759005_1000759006 2 Left 1000759005 5:165197854-165197876 CCTTATGAGTGGGAGCTAAATGA No data
Right 1000759006 5:165197879-165197901 AGAACTCATGAACACAAAGAAGG No data
1000759001_1000759006 21 Left 1000759001 5:165197835-165197857 CCAAATACTGCATGTTTTCCCTT No data
Right 1000759006 5:165197879-165197901 AGAACTCATGAACACAAAGAAGG No data
1000759004_1000759006 3 Left 1000759004 5:165197853-165197875 CCCTTATGAGTGGGAGCTAAATG No data
Right 1000759006 5:165197879-165197901 AGAACTCATGAACACAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000759006 Original CRISPR AGAACTCATGAACACAAAGA AGG Intergenic