ID: 1000759009

View in Genome Browser
Species Human (GRCh38)
Location 5:165197896-165197918
Sequence AGAAGGGAACAGCAGACACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000759004_1000759009 20 Left 1000759004 5:165197853-165197875 CCCTTATGAGTGGGAGCTAAATG No data
Right 1000759009 5:165197896-165197918 AGAAGGGAACAGCAGACACTGGG No data
1000759005_1000759009 19 Left 1000759005 5:165197854-165197876 CCTTATGAGTGGGAGCTAAATGA No data
Right 1000759009 5:165197896-165197918 AGAAGGGAACAGCAGACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000759009 Original CRISPR AGAAGGGAACAGCAGACACT GGG Intergenic