ID: 1000760145

View in Genome Browser
Species Human (GRCh38)
Location 5:165213496-165213518
Sequence GTATGTGCACATGTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000760145_1000760150 16 Left 1000760145 5:165213496-165213518 CCCCAGCACACATGTGCACATAC No data
Right 1000760150 5:165213535-165213557 CACTTTATCAATGAAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000760145 Original CRISPR GTATGTGCACATGTGTGCTG GGG (reversed) Intergenic