ID: 1000760150

View in Genome Browser
Species Human (GRCh38)
Location 5:165213535-165213557
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000760147_1000760150 14 Left 1000760147 5:165213498-165213520 CCAGCACACATGTGCACATACAC No data
Right 1000760150 5:165213535-165213557 CACTTTATCAATGAAAACACAGG No data
1000760145_1000760150 16 Left 1000760145 5:165213496-165213518 CCCCAGCACACATGTGCACATAC No data
Right 1000760150 5:165213535-165213557 CACTTTATCAATGAAAACACAGG No data
1000760146_1000760150 15 Left 1000760146 5:165213497-165213519 CCCAGCACACATGTGCACATACA No data
Right 1000760150 5:165213535-165213557 CACTTTATCAATGAAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000760150 Original CRISPR CACTTTATCAATGAAAACAC AGG Intergenic
No off target data available for this crispr