ID: 1000765349

View in Genome Browser
Species Human (GRCh38)
Location 5:165282676-165282698
Sequence GGGTCTAACCAGATGTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000765349_1000765356 21 Left 1000765349 5:165282676-165282698 CCAGGCTACATCTGGTTAGACCC No data
Right 1000765356 5:165282720-165282742 ATTCAAAACCATTGGCTGTGTGG No data
1000765349_1000765355 13 Left 1000765349 5:165282676-165282698 CCAGGCTACATCTGGTTAGACCC No data
Right 1000765355 5:165282712-165282734 CAGCTGGAATTCAAAACCATTGG No data
1000765349_1000765353 -3 Left 1000765349 5:165282676-165282698 CCAGGCTACATCTGGTTAGACCC No data
Right 1000765353 5:165282696-165282718 CCCTGGGCTTGAATTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000765349 Original CRISPR GGGTCTAACCAGATGTAGCC TGG (reversed) Intergenic
No off target data available for this crispr