ID: 1000765824 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:165287084-165287106 |
| Sequence | GTCAGTCTTTGGGCCCCAGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1000765824_1000765833 | 30 | Left | 1000765824 | 5:165287084-165287106 | CCACCTGGGGCCCAAAGACTGAC | No data | ||
| Right | 1000765833 | 5:165287137-165287159 | TGACAGCATCTACCAGCTAAGGG | No data | ||||
| 1000765824_1000765832 | 29 | Left | 1000765824 | 5:165287084-165287106 | CCACCTGGGGCCCAAAGACTGAC | No data | ||
| Right | 1000765832 | 5:165287136-165287158 | ATGACAGCATCTACCAGCTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1000765824 | Original CRISPR | GTCAGTCTTTGGGCCCCAGG TGG (reversed) | Intergenic | ||