ID: 1000765824

View in Genome Browser
Species Human (GRCh38)
Location 5:165287084-165287106
Sequence GTCAGTCTTTGGGCCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000765824_1000765833 30 Left 1000765824 5:165287084-165287106 CCACCTGGGGCCCAAAGACTGAC No data
Right 1000765833 5:165287137-165287159 TGACAGCATCTACCAGCTAAGGG No data
1000765824_1000765832 29 Left 1000765824 5:165287084-165287106 CCACCTGGGGCCCAAAGACTGAC No data
Right 1000765832 5:165287136-165287158 ATGACAGCATCTACCAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000765824 Original CRISPR GTCAGTCTTTGGGCCCCAGG TGG (reversed) Intergenic