ID: 1000768416

View in Genome Browser
Species Human (GRCh38)
Location 5:165319765-165319787
Sequence CAAAAAGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000768416_1000768419 4 Left 1000768416 5:165319765-165319787 CCCATATCACTATCAGCTTTTTG No data
Right 1000768419 5:165319792-165319814 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000768416 Original CRISPR CAAAAAGCTGATAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr