ID: 1000772130

View in Genome Browser
Species Human (GRCh38)
Location 5:165367971-165367993
Sequence TGTCCACTGCTCAGAGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000772130_1000772134 21 Left 1000772130 5:165367971-165367993 CCCCACACTCTGAGCAGTGGACA No data
Right 1000772134 5:165368015-165368037 CAGTTCTGACATTATCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000772130 Original CRISPR TGTCCACTGCTCAGAGTGTG GGG (reversed) Intergenic
No off target data available for this crispr