ID: 1000772711

View in Genome Browser
Species Human (GRCh38)
Location 5:165376702-165376724
Sequence AAGCTGTGCTAGAGGGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000772706_1000772711 24 Left 1000772706 5:165376655-165376677 CCTGTGGTGCATGCAATGAAATT No data
Right 1000772711 5:165376702-165376724 AAGCTGTGCTAGAGGGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000772711 Original CRISPR AAGCTGTGCTAGAGGGCAAC TGG Intergenic
No off target data available for this crispr