ID: 1000773578

View in Genome Browser
Species Human (GRCh38)
Location 5:165388554-165388576
Sequence GCAGGCACACATGGCAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000773578_1000773585 24 Left 1000773578 5:165388554-165388576 CCATTACTGCCATGTGTGCCTGC No data
Right 1000773585 5:165388601-165388623 CAGACCCTGAACCCAGTATAGGG No data
1000773578_1000773584 23 Left 1000773578 5:165388554-165388576 CCATTACTGCCATGTGTGCCTGC No data
Right 1000773584 5:165388600-165388622 ACAGACCCTGAACCCAGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000773578 Original CRISPR GCAGGCACACATGGCAGTAA TGG (reversed) Intergenic