ID: 1000774674

View in Genome Browser
Species Human (GRCh38)
Location 5:165404328-165404350
Sequence ATTGAGTACCTAAATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000774673_1000774674 13 Left 1000774673 5:165404292-165404314 CCTTTGGCTTTGTAGGATTAATA No data
Right 1000774674 5:165404328-165404350 ATTGAGTACCTAAATGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000774674 Original CRISPR ATTGAGTACCTAAATGAAGA TGG Intergenic
No off target data available for this crispr