ID: 1000777854

View in Genome Browser
Species Human (GRCh38)
Location 5:165442079-165442101
Sequence CTGTGCTAGGGCAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000777854_1000777867 29 Left 1000777854 5:165442079-165442101 CCTTCCACATTGCCCTAGCACAG No data
Right 1000777867 5:165442131-165442153 AAACTTCTGCCTGGGCACCCAGG 0: 6
1: 390
2: 1243
3: 1725
4: 1998
1000777854_1000777864 20 Left 1000777854 5:165442079-165442101 CCTTCCACATTGCCCTAGCACAG No data
Right 1000777864 5:165442122-165442144 CCCTGCAGCAAACTTCTGCCTGG 0: 721
1: 1546
2: 1624
3: 1286
4: 1036
1000777854_1000777866 21 Left 1000777854 5:165442079-165442101 CCTTCCACATTGCCCTAGCACAG No data
Right 1000777866 5:165442123-165442145 CCTGCAGCAAACTTCTGCCTGGG 0: 308
1: 632
2: 524
3: 419
4: 420
1000777854_1000777859 -10 Left 1000777854 5:165442079-165442101 CCTTCCACATTGCCCTAGCACAG No data
Right 1000777859 5:165442092-165442114 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078
1000777854_1000777860 -9 Left 1000777854 5:165442079-165442101 CCTTCCACATTGCCCTAGCACAG No data
Right 1000777860 5:165442093-165442115 CTAGCACAGGTTCTCCATGAGGG 0: 16
1: 1111
2: 1516
3: 1250
4: 912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000777854 Original CRISPR CTGTGCTAGGGCAATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr