ID: 1000778860

View in Genome Browser
Species Human (GRCh38)
Location 5:165454231-165454253
Sequence AATCTAACCCCTGTGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000778860_1000778862 1 Left 1000778860 5:165454231-165454253 CCTTCCTTCACAGGGGTTAGATT No data
Right 1000778862 5:165454255-165454277 ATTTTCTTGTGTATTTTTGCAGG No data
1000778860_1000778863 2 Left 1000778860 5:165454231-165454253 CCTTCCTTCACAGGGGTTAGATT No data
Right 1000778863 5:165454256-165454278 TTTTCTTGTGTATTTTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000778860 Original CRISPR AATCTAACCCCTGTGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr