ID: 1000779268

View in Genome Browser
Species Human (GRCh38)
Location 5:165460014-165460036
Sequence AGTCTCCCGTTTCCAAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000779265_1000779268 5 Left 1000779265 5:165459986-165460008 CCACCACGCTGAGCCTATGATTC No data
Right 1000779268 5:165460014-165460036 AGTCTCCCGTTTCCAAATAAAGG No data
1000779266_1000779268 2 Left 1000779266 5:165459989-165460011 CCACGCTGAGCCTATGATTCGAT No data
Right 1000779268 5:165460014-165460036 AGTCTCCCGTTTCCAAATAAAGG No data
1000779267_1000779268 -8 Left 1000779267 5:165459999-165460021 CCTATGATTCGATTCAGTCTCCC No data
Right 1000779268 5:165460014-165460036 AGTCTCCCGTTTCCAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000779268 Original CRISPR AGTCTCCCGTTTCCAAATAA AGG Intergenic
No off target data available for this crispr