ID: 1000779686

View in Genome Browser
Species Human (GRCh38)
Location 5:165465172-165465194
Sequence TTACCACAGCCGGTGCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000779679_1000779686 4 Left 1000779679 5:165465145-165465167 CCTGCCCACCACCAGTTCCTCTT No data
Right 1000779686 5:165465172-165465194 TTACCACAGCCGGTGCTCTCTGG No data
1000779678_1000779686 5 Left 1000779678 5:165465144-165465166 CCCTGCCCACCACCAGTTCCTCT No data
Right 1000779686 5:165465172-165465194 TTACCACAGCCGGTGCTCTCTGG No data
1000779680_1000779686 0 Left 1000779680 5:165465149-165465171 CCCACCACCAGTTCCTCTTCATA No data
Right 1000779686 5:165465172-165465194 TTACCACAGCCGGTGCTCTCTGG No data
1000779683_1000779686 -7 Left 1000779683 5:165465156-165465178 CCAGTTCCTCTTCATATTACCAC No data
Right 1000779686 5:165465172-165465194 TTACCACAGCCGGTGCTCTCTGG No data
1000779682_1000779686 -4 Left 1000779682 5:165465153-165465175 CCACCAGTTCCTCTTCATATTAC No data
Right 1000779686 5:165465172-165465194 TTACCACAGCCGGTGCTCTCTGG No data
1000779681_1000779686 -1 Left 1000779681 5:165465150-165465172 CCACCACCAGTTCCTCTTCATAT No data
Right 1000779686 5:165465172-165465194 TTACCACAGCCGGTGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000779686 Original CRISPR TTACCACAGCCGGTGCTCTC TGG Intergenic
No off target data available for this crispr