ID: 1000780440

View in Genome Browser
Species Human (GRCh38)
Location 5:165473749-165473771
Sequence CATTCCAAAGATAAGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000780440_1000780442 -2 Left 1000780440 5:165473749-165473771 CCTCAGAACTTATCTTTGGAATG No data
Right 1000780442 5:165473770-165473792 TGAGAGAGAAGGCATTCTGCTGG No data
1000780440_1000780443 18 Left 1000780440 5:165473749-165473771 CCTCAGAACTTATCTTTGGAATG No data
Right 1000780443 5:165473790-165473812 TGGAAATAAATGTTAAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000780440 Original CRISPR CATTCCAAAGATAAGTTCTG AGG (reversed) Intergenic
No off target data available for this crispr