ID: 1000780508

View in Genome Browser
Species Human (GRCh38)
Location 5:165474397-165474419
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000780508_1000780510 5 Left 1000780508 5:165474397-165474419 CCTGGGAAGCAAACTTTGAGATC No data
Right 1000780510 5:165474425-165474447 TAGCCTGCTAGAAATTTATCAGG No data
1000780508_1000780513 17 Left 1000780508 5:165474397-165474419 CCTGGGAAGCAAACTTTGAGATC No data
Right 1000780513 5:165474437-165474459 AATTTATCAGGGAATGTTTATGG No data
1000780508_1000780511 6 Left 1000780508 5:165474397-165474419 CCTGGGAAGCAAACTTTGAGATC No data
Right 1000780511 5:165474426-165474448 AGCCTGCTAGAAATTTATCAGGG No data
1000780508_1000780514 18 Left 1000780508 5:165474397-165474419 CCTGGGAAGCAAACTTTGAGATC No data
Right 1000780514 5:165474438-165474460 ATTTATCAGGGAATGTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000780508 Original CRISPR GATCTCAAAGTTTGCTTCCC AGG (reversed) Intergenic