ID: 1000780510

View in Genome Browser
Species Human (GRCh38)
Location 5:165474425-165474447
Sequence TAGCCTGCTAGAAATTTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000780508_1000780510 5 Left 1000780508 5:165474397-165474419 CCTGGGAAGCAAACTTTGAGATC No data
Right 1000780510 5:165474425-165474447 TAGCCTGCTAGAAATTTATCAGG No data
1000780507_1000780510 6 Left 1000780507 5:165474396-165474418 CCCTGGGAAGCAAACTTTGAGAT No data
Right 1000780510 5:165474425-165474447 TAGCCTGCTAGAAATTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000780510 Original CRISPR TAGCCTGCTAGAAATTTATC AGG Intergenic