ID: 1000780519

View in Genome Browser
Species Human (GRCh38)
Location 5:165474469-165474491
Sequence CTGTGTAAAGGAAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000780512_1000780519 18 Left 1000780512 5:165474428-165474450 CCTGCTAGAAATTTATCAGGGAA No data
Right 1000780519 5:165474469-165474491 CTGTGTAAAGGAAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000780519 Original CRISPR CTGTGTAAAGGAAAGGAGGC AGG Intergenic
No off target data available for this crispr