ID: 1000781056

View in Genome Browser
Species Human (GRCh38)
Location 5:165481777-165481799
Sequence CTGCATGAATAGATCATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000781056_1000781059 30 Left 1000781056 5:165481777-165481799 CCATGCATGATCTATTCATGCAG No data
Right 1000781059 5:165481830-165481852 TAGATCATTTAGAACTATTGTGG No data
1000781056_1000781057 3 Left 1000781056 5:165481777-165481799 CCATGCATGATCTATTCATGCAG No data
Right 1000781057 5:165481803-165481825 TCCTTGTTGTTGAAAAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000781056 Original CRISPR CTGCATGAATAGATCATGCA TGG (reversed) Intergenic
No off target data available for this crispr