ID: 1000782978

View in Genome Browser
Species Human (GRCh38)
Location 5:165507144-165507166
Sequence AAGGCTCTTGCACTTGTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000782978_1000782985 11 Left 1000782978 5:165507144-165507166 CCCCCGACAAGTGCAAGAGCCTT No data
Right 1000782985 5:165507178-165507200 TGTTTGTCAAAAACAATTACAGG No data
1000782978_1000782986 30 Left 1000782978 5:165507144-165507166 CCCCCGACAAGTGCAAGAGCCTT No data
Right 1000782986 5:165507197-165507219 CAGGCTATCATTTAACTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000782978 Original CRISPR AAGGCTCTTGCACTTGTCGG GGG (reversed) Intergenic
No off target data available for this crispr