ID: 1000788141

View in Genome Browser
Species Human (GRCh38)
Location 5:165571317-165571339
Sequence GAAAATGTTGATAATGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000788141_1000788143 4 Left 1000788141 5:165571317-165571339 CCCACATCATTATCAACATTTTC No data
Right 1000788143 5:165571344-165571366 AAACCATTCAACAAGTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000788141 Original CRISPR GAAAATGTTGATAATGATGT GGG (reversed) Intergenic
No off target data available for this crispr