ID: 1000796752

View in Genome Browser
Species Human (GRCh38)
Location 5:165673611-165673633
Sequence CACTTTTATAACTATAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000796751_1000796752 6 Left 1000796751 5:165673582-165673604 CCTTTTAGAAATTAGACTTTATA No data
Right 1000796752 5:165673611-165673633 CACTTTTATAACTATAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000796752 Original CRISPR CACTTTTATAACTATAAGCT TGG Intergenic
No off target data available for this crispr