ID: 1000800137

View in Genome Browser
Species Human (GRCh38)
Location 5:165715499-165715521
Sequence TAGGGCTGAATACTTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000800137_1000800145 6 Left 1000800137 5:165715499-165715521 CCTGGGGCAAGTATTCAGCCCTA No data
Right 1000800145 5:165715528-165715550 TTGAGGATCTTCAGGGAGCAGGG No data
1000800137_1000800141 -2 Left 1000800137 5:165715499-165715521 CCTGGGGCAAGTATTCAGCCCTA No data
Right 1000800141 5:165715520-165715542 TAGTCCAGTTGAGGATCTTCAGG No data
1000800137_1000800146 12 Left 1000800137 5:165715499-165715521 CCTGGGGCAAGTATTCAGCCCTA No data
Right 1000800146 5:165715534-165715556 ATCTTCAGGGAGCAGGGCCATGG No data
1000800137_1000800144 5 Left 1000800137 5:165715499-165715521 CCTGGGGCAAGTATTCAGCCCTA No data
Right 1000800144 5:165715527-165715549 GTTGAGGATCTTCAGGGAGCAGG No data
1000800137_1000800147 25 Left 1000800137 5:165715499-165715521 CCTGGGGCAAGTATTCAGCCCTA No data
Right 1000800147 5:165715547-165715569 AGGGCCATGGAGTAAACAATAGG No data
1000800137_1000800148 26 Left 1000800137 5:165715499-165715521 CCTGGGGCAAGTATTCAGCCCTA No data
Right 1000800148 5:165715548-165715570 GGGCCATGGAGTAAACAATAGGG No data
1000800137_1000800142 -1 Left 1000800137 5:165715499-165715521 CCTGGGGCAAGTATTCAGCCCTA No data
Right 1000800142 5:165715521-165715543 AGTCCAGTTGAGGATCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000800137 Original CRISPR TAGGGCTGAATACTTGCCCC AGG (reversed) Intergenic
No off target data available for this crispr